PB_Mut(D1399Y)_p300_core-dCas9-EGFP_hygro
(Plasmid #226427)

• Purpose: PiggyBac transposon vector containing a dox inducible mutant p300 core-dCas9 fusion protein (p300 core mutation: D1399Y) and EGFP reporter. Hygromycin selection marker.
• Depositing Lab: Alon Goren
• Publication: PiggyBac CRISPR-dCas9 fusion protein and gRNA donor plasmids (unpublished)

Backbone

• Vector backbone: PiggyBac dCas9-VPR
• Backbone size w/o insert (bp): 15642
• Total vector size (bp): 16392
• Modifications to backbone: Changed the BFP reporter gene to EGFP and swapped the puromycin resistance for hygromycin resistance. Removed the BspQI restriction enzyme site. Swapped the VPR for the mutant p300 core.
• Vector type: Mammalian Expression, CRISPR, Synthetic Biology ; PiggyBac Transposon
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Mutant p300 core-dCas9-EGFP fusion protein
• Species: H. sapiens (human), Synthetic; Streptococcus pyogenes
• Insert Size (bp): 6912
• Mutation: p300 core mutation (D1399Y)
• Promoter: Dox inducible minimal CMV
• Tags / Fusion Proteins:
  • Mutant p300 core (N terminal on insert)
  • HA tag (C terminal on insert)
  • P2A-EGFP (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: attttcaaaccagaagaactacgacag

Gene/Insert 2

• Gene/Insert name: rtTA3-IRES-Hygro
• Species: Synthetic
• Insert Size (bp): 2365
• Promoter: UbC Promoter

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cgataataccatgAAAAAGCCTGAACTCAC

Resource Information

• Supplemental Documents:
  • bgg328-pb_mutd1399y_p300_core-dcas9-egfp_hygro.gb
• A portion of this plasmid was derived from a plasmid made by: The mutant p300 core sequence was PCR amplified from pcDNA-dCas9- p300 (D1399Y) (Addgene #61358), and the EGFP was PCR amplified from pGL3-U6-sgRNA-EGFP (Addgene #107721).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry