pCRISPRi-ccdB
(Plasmid
#226432)
-
PurposeThis vector enhances CRISPRi sgRNA cloning efficiency via Golden Gate assembly, replacing the ccdB toxin gene for positive selection of successful insertions.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 226432 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepJMP2846
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin (100 μg/mL ) and Apramycin (30 μg/mL)
-
Growth Temperature37°C
-
Growth Strain(s)S17-1λpir gyrAR462C
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namedCas9
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)4104
- Promoter Ptet
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer tgcgactactcttgcctactaccta
- 3′ sequencing primer gagcacatcagcaggtttcacacag
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameccdB
-
SpeciesSynthetic
-
Insert Size (bp)340
- Promoter P3
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer gaaagaattcctaaagatctTCGTCGGCAGCGTCAGAT
- 3′ sequencing primer gaacggtcagccacatgaatGTCTCGTGGGCTCGGAGATG
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nametetR
-
SpeciesSynthetic
-
Insert Size (bp)624
- Promoter Pcon
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer cctgctgatgtgctctgtgctcagtatctctatcactgataggg
- 3′ sequencing primer gcaagagtagtcgcaaaaaaattagcgcaagaagacaaaaatc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.09.01.610675 for bioRxiv preprint.
S17-1λpir gyrAR462C strain genotype: TpR SmR recA, thi, pro, hsdR-M+RP4: 2-Tc:Mu: Km Tn7 λpir, gyrAR462C.
Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPRi-ccdB was a gift from Xue Liu (Addgene plasmid # 226432) -
For your References section:
CRISPRi screen identifies FprB as a synergistic target for gallium therapy in Pseudomonas aeruginosa. Zhang Y, Zhang T, Xiao X, Wang Y, Kawalek A, Ou J, Ren A, Sun W, de Bakker V, Liu Y, Li Y, Yang L, Ye L, Jia N, Veening JW, Liu X. Nat Commun. 2025 Jul 1;16(1):5870. doi: 10.1038/s41467-025-61208-z. 10.1038/s41467-025-61208-z PubMed 40595632