Skip to main content
Addgene

pCRISPRi-ccdB
(Plasmid #226432)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 226432 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJMP2846
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin (100 μg/mL ) and Apramycin (30 μg/mL)
  • Growth Temperature
    37°C
  • Growth Strain(s)
    S17-1λpir gyrAR462C
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    dCas9
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
    4104
  • Promoter Ptet

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tgcgactactcttgcctactaccta
  • 3′ sequencing primer gagcacatcagcaggtttcacacag
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    ccdB
  • Species
    Synthetic
  • Insert Size (bp)
    340
  • Promoter P3

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gaaagaattcctaaagatctTCGTCGGCAGCGTCAGAT
  • 3′ sequencing primer gaacggtcagccacatgaatGTCTCGTGGGCTCGGAGATG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    tetR
  • Species
    Synthetic
  • Insert Size (bp)
    624
  • Promoter Pcon

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cctgctgatgtgctctgtgctcagtatctctatcactgataggg
  • 3′ sequencing primer gcaagagtagtcgcaaaaaaattagcgcaagaagacaaaaatc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.09.01.610675 for bioRxiv preprint.

S17-1λpir gyrAR462C strain genotype: TpR SmR recA, thi, pro, hsdR-M+RP4: 2-Tc:Mu: Km Tn7 λpir, gyrAR462C.

Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRISPRi-ccdB was a gift from Xue Liu (Addgene plasmid # 226432)
  • For your References section:

    CRISPRi screen identifies FprB as a synergistic target for gallium therapy in Pseudomonas aeruginosa. Zhang Y, Zhang T, Xiao X, Wang Y, Kawalek A, Ou J, Ren A, Sun W, de Bakker V, Liu Y, Li Y, Yang L, Ye L, Jia N, Veening JW, Liu X. Nat Commun. 2025 Jul 1;16(1):5870. doi: 10.1038/s41467-025-61208-z. 10.1038/s41467-025-61208-z PubMed 40595632