ptet-lux-Tn7T-Gm
(Plasmid
#226434)
-
PurposeThis vector features a tetracycline-inducible system to regulate luxABCDE reporter expression, optimized for efficiency in P. aeruginosa.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 226434 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC18T-mini-Tn7T-P3-luxABCDE
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Gentamicin, 100 & 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)E. coli S17-1λpir (ATCC-BAA-2428)
-
Growth instructionsE. coli strain WM3064 with supplementation with DAP (300 μM) + Gentamicin (20 μg/mL) should be used for downstream expression and conjugation experiments.
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameoptimized TetR
-
Alt nametetR-opt
-
SpeciesSynthetic
-
Insert Size (bp)624
- Promoter Pcon
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ctcactagtggatCCaaaaaattagcgcaagaagacaaaaatc
- 3′ sequencing primer ccgccgaagcggggttttttgcgGAATTCGAGCTCGGTACCTCGCGAATG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameluxABCDE
-
Insert Size (bp)5799
- Promoter Ptet
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer accccgcttcggcggggttttttcgcGGATCTAGACGGTGATCAACACG
- 3′ sequencing primer atttttttagtcattgattgtacctcctgg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.09.01.610675 for bioRxiv preprint.
S17-1λpir strain genotype: TpR SmR recA, thi, pro, hsdR-M+RP4: 2-Tc:Mu: Km Tn7 λpir
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ptet-lux-Tn7T-Gm was a gift from Xue Liu (Addgene plasmid # 226434 ; http://n2t.net/addgene:226434 ; RRID:Addgene_226434) -
For your References section:
CRISPRi screen identifies FprB as a synergistic target for gallium therapy in Pseudomonas aeruginosa. Zhang Y, Zhang T, Xiao X, Wang Y, Kawalek A, Ou J, Ren A, Sun W, de Bakker V, Liu Y, Li Y, Yang L, Ye L, Jia N, Veening JW, Liu X. Nat Commun. 2025 Jul 1;16(1):5870. doi: 10.1038/s41467-025-61208-z. 10.1038/s41467-025-61208-z PubMed 40595632