Skip to main content
Addgene

ptet-lux-Tn7T-Gm
(Plasmid #226434)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 226434 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC18T-mini-Tn7T-P3-luxABCDE
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Gentamicin, 100 & 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    E. coli S17-1λpir (ATCC-BAA-2428)
  • Growth instructions
    E. coli strain WM3064 with supplementation with DAP (300 μM) + Gentamicin (20 μg/mL) should be used for downstream expression and conjugation experiments.
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    optimized TetR
  • Alt name
    tetR-opt
  • Species
    Synthetic
  • Insert Size (bp)
    624
  • Promoter Pcon

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ctcactagtggatCCaaaaaattagcgcaagaagacaaaaatc
  • 3′ sequencing primer ccgccgaagcggggttttttgcgGAATTCGAGCTCGGTACCTCGCGAATG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    luxABCDE
  • Insert Size (bp)
    5799
  • Promoter Ptet

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer accccgcttcggcggggttttttcgcGGATCTAGACGGTGATCAACACG
  • 3′ sequencing primer atttttttagtcattgattgtacctcctgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.09.01.610675 for bioRxiv preprint.

S17-1λpir strain genotype: TpR SmR recA, thi, pro, hsdR-M+RP4: 2-Tc:Mu: Km Tn7 λpir

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ptet-lux-Tn7T-Gm was a gift from Xue Liu (Addgene plasmid # 226434 ; http://n2t.net/addgene:226434 ; RRID:Addgene_226434)
  • For your References section:

    CRISPRi screen identifies FprB as a synergistic target for gallium therapy in Pseudomonas aeruginosa. Zhang Y, Zhang T, Xiao X, Wang Y, Kawalek A, Ou J, Ren A, Sun W, de Bakker V, Liu Y, Li Y, Yang L, Ye L, Jia N, Veening JW, Liu X. Nat Commun. 2025 Jul 1;16(1):5870. doi: 10.1038/s41467-025-61208-z. 10.1038/s41467-025-61208-z PubMed 40595632