Skip to main content
Addgene

3xFLAG-DGKδ2-ΔSAMD
(Plasmid #226507)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 226507 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    p3xFLAG-CMV-7.1
  • Backbone manufacturer
    Sigma Aldrich
  • Backbone size w/o insert (bp) 4717
  • Total vector size (bp) 8118
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DGKD
  • Alt name
    Diacylglycerol kinase delta 2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3432
  • Mutation
    deleted sterile alpha motif domain (deleted amino acids 1142–1214)
  • GenBank ID
    NM_152879.3
  • Entrez Gene
    DGKD (a.k.a. DGK-delta, DGKdelta, dgkd-2)
  • Promoter CMV
  • Tags / Fusion Proteins
    • Three tandem FLAG epitope tag (N terminal on backbone)
    • enterokinase cleavage site (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    3xFLAG-DGKδ2-ΔSAMD was a gift from Chiaki Murakami & Fumio Sakane (Addgene plasmid # 226507 ; http://n2t.net/addgene:226507 ; RRID:Addgene_226507)
  • For your References section:

    Diacylglycerol kinase delta and sphingomyelin synthase-related protein functionally interact via their sterile alpha motif domains. Murakami C, Hoshino F, Sakai H, Hayashi Y, Yamashita A, Sakane F. J Biol Chem. 2020 Mar 6;295(10):2932-2947. doi: 10.1074/jbc.RA119.012369. Epub 2020 Jan 24. 10.1074/jbc.RA119.012369 PubMed 31980461