lentiGuideFE-mSG-Puro
(Plasmid
#226522)
-
PurposeCas9 guide RNA scaffold with the F+E scaffold modification with mStayGold-P2A-Puro
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 226522 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLentiRNAGuide_003
- Backbone size w/o insert (bp) 7531
- Total vector size (bp) 9516
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehU6_SpCas9gRNAF+E_EF1a_mStayGold_P2A_Puro
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1985
- Promoter U6,EF1a
-
Tag
/ Fusion Protein
- mStayGold
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer GACTATCATATGCTTACCGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lentiGuideFE-mSG-Puro was a gift from Neville Sanjana (Addgene plasmid # 226522 ; http://n2t.net/addgene:226522 ; RRID:Addgene_226522) -
For your References section:
Comprehensive dissection of cis-regulatory elements in a 2.8 Mb topologically associated domain in six human cancers. Caragine CM, Le VT, Mustafa M, Diaz BJ, Morris JA, Muller S, Mendez-Mancilla A, Geller E, Liscovitch-Brauer N, Sanjana NE. Nat Commun. 2025 Feb 13;16(1):1611. doi: 10.1038/s41467-025-56568-5. 10.1038/s41467-025-56568-5 PubMed 39948336