Skip to main content

lentiGuideFE-mSG-Puro
(Plasmid #226522)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 226522 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLentiRNAGuide_003
  • Backbone size w/o insert (bp) 7531
  • Total vector size (bp) 9516
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hU6_SpCas9gRNAF+E_EF1a_mStayGold_P2A_Puro
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1985
  • Promoter U6,EF1a
  • Tag / Fusion Protein
    • mStayGold

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiGuideFE-mSG-Puro was a gift from Neville Sanjana (Addgene plasmid # 226522 ; http://n2t.net/addgene:226522 ; RRID:Addgene_226522)
  • For your References section:

    Comprehensive dissection of cis-regulatory elements in a 2.8 Mb topologically associated domain in six human cancers. Caragine CM, Le VT, Mustafa M, Diaz BJ, Morris JA, Muller S, Mendez-Mancilla A, Geller E, Liscovitch-Brauer N, Sanjana NE. Nat Commun. 2025 Feb 13;16(1):1611. doi: 10.1038/s41467-025-56568-5. 10.1038/s41467-025-56568-5 PubMed 39948336