pFB-D3-ASK1
(Plasmid
#226619)
-
PurposeCo-expression of D3 and ASK1 complex in insect cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 226619 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFastBAC
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 9231
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameD3
-
SpeciesO. sativa
-
MutationThe flexible loop in D3 (Q478-D515) can be removed by TEV
-
GenBank IDNM_001424596.1
- Promoter Polyhedrin
-
Tag
/ Fusion Protein
- His tag followed with three copies of Msyb (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ggattattcataccgtccca
- 3′ sequencing primer caaatgtggtatggctgatt
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameASK1
-
SpeciesA. thaliana (mustard weed)
-
Entrez GeneSKP1 (a.k.a. AT1G75950, ARABIDOPSIS SKP1 HOMOLOGUE 1, ASK1, ATSKP1, S phase kinase-associated protein 1, SKP1A, T4O12.17, T4O12_17, UFO INTERACTING PROTEIN 1, UIP1)
- Promoter Polyhedrin
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ggattattcataccgtccca
- 3′ sequencing primer caaatgtggtatggctgatt
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFB-D3-ASK1 was a gift from Ning Zheng (Addgene plasmid # 226619 ; http://n2t.net/addgene:226619 ; RRID:Addgene_226619) -
For your References section:
Structural plasticity of D3-D14 ubiquitin ligase in strigolactone signalling. Shabek N, Ticchiarelli F, Mao H, Hinds TR, Leyser O, Zheng N. Nature. 2018 Nov;563(7733):652-656. doi: 10.1038/s41586-018-0743-5. Epub 2018 Nov 21. 10.1038/s41586-018-0743-5 PubMed 30464344