pRSFDuet-FBXL5-SKP1
(Plasmid
#226620)
-
PurposeCo-expression of FBXL5-SKP1 complex in E.coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 226620 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRSFDuet
- Backbone size w/o insert (bp) 3800
- Total vector size (bp) 5416
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameFBXL5
-
SpeciesH. sapiens (human)
-
Insert Size (bp)963
-
MutationAmino acids 1-198 was deleted, and 420-596 was replaced by a short linker GSGGG
-
GenBank IDNM_012161.4
-
Entrez GeneFBXL5 (a.k.a. FBL4, FBL5, FLR1)
- Promoter T7
-
Tag
/ Fusion Protein
- GB1 (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer taatacgactcactatag
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameSKP1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)492
-
GenBank IDNM_170679.3
-
Entrez GeneSKP1 (a.k.a. EMC19, OCP-II, OCP2, SKP1A, TCEB1L, p19A)
- Promoter T7
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer gtatattagttaagtataagaaggaga
- 3′ sequencing primer gctagttattgctcagcgg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSFDuet-FBXL5-SKP1 was a gift from Ning Zheng (Addgene plasmid # 226620 ; http://n2t.net/addgene:226620 ; RRID:Addgene_226620) -
For your References section:
FBXL5 Regulates IRP2 Stability in Iron Homeostasis via an Oxygen-Responsive [2Fe2S] Cluster. Wang H, Shi H, Rajan M, Canarie ER, Hong S, Simoneschi D, Pagano M, Bush MF, Stoll S, Leibold EA, Zheng N. Mol Cell. 2020 Apr 2;78(1):31-41.e5. doi: 10.1016/j.molcel.2020.02.011. Epub 2020 Mar 2. 10.1016/j.molcel.2020.02.011 PubMed 32126207