Skip to main content

pRSFDuet-FBXL5-SKP1
(Plasmid #226620)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 226620 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRSFDuet
  • Backbone size w/o insert (bp) 3800
  • Total vector size (bp) 5416
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    FBXL5
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    963
  • Mutation
    Amino acids 1-198 was deleted, and 420-596 was replaced by a short linker GSGGG
  • GenBank ID
    NM_012161.4
  • Entrez Gene
    FBXL5 (a.k.a. FBL4, FBL5, FLR1)
  • Promoter T7
  • Tag / Fusion Protein
    • GB1 (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer taatacgactcactatag
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    SKP1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    492
  • GenBank ID
    NM_170679.3
  • Entrez Gene
    SKP1 (a.k.a. EMC19, OCP-II, OCP2, SKP1A, TCEB1L, p19A)
  • Promoter T7

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer gtatattagttaagtataagaaggaga
  • 3′ sequencing primer gctagttattgctcagcgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRSFDuet-FBXL5-SKP1 was a gift from Ning Zheng (Addgene plasmid # 226620 ; http://n2t.net/addgene:226620 ; RRID:Addgene_226620)
  • For your References section:

    FBXL5 Regulates IRP2 Stability in Iron Homeostasis via an Oxygen-Responsive [2Fe2S] Cluster. Wang H, Shi H, Rajan M, Canarie ER, Hong S, Simoneschi D, Pagano M, Bush MF, Stoll S, Leibold EA, Zheng N. Mol Cell. 2020 Apr 2;78(1):31-41.e5. doi: 10.1016/j.molcel.2020.02.011. Epub 2020 Mar 2. 10.1016/j.molcel.2020.02.011 PubMed 32126207