Skip to main content

pFB-GST-IRP2
(Plasmid #226621)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 226621 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFastBAC
  • Backbone size w/o insert (bp) 5739
  • Total vector size (bp) 8634
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IRP2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2892
  • GenBank ID
    NM_004136.4
  • Entrez Gene
    IREB2 (a.k.a. ACO3, IRE-BP 2, IRE-BP2, IRP2, IRP2AD, NDCAMA)
  • Promoter Polyhedrin
  • Tag / Fusion Protein
    • GST (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer gggctggcaagccacgtttggtg
  • 3′ sequencing primer caaatgtggtatggctgatt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFB-GST-IRP2 was a gift from Ning Zheng (Addgene plasmid # 226621 ; http://n2t.net/addgene:226621 ; RRID:Addgene_226621)
  • For your References section:

    FBXL5 Regulates IRP2 Stability in Iron Homeostasis via an Oxygen-Responsive [2Fe2S] Cluster. Wang H, Shi H, Rajan M, Canarie ER, Hong S, Simoneschi D, Pagano M, Bush MF, Stoll S, Leibold EA, Zheng N. Mol Cell. 2020 Apr 2;78(1):31-41.e5. doi: 10.1016/j.molcel.2020.02.011. Epub 2020 Mar 2. 10.1016/j.molcel.2020.02.011 PubMed 32126207