pCKC017
(Plasmid
#226622)
-
PurposepLenti wt hTdT template for libraries 1-2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 226622 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLenti CMV Blast Dest (Addgene #17451)
- Backbone size w/o insert (bp) 8100
-
Modifications to backboneAmpicillin resistance gene was replaced with kanamycin resistance, the CMV promoter sequence was extended, and a a pPGK-sfGFP-P2A-puroR cassette was added
-
Vector typeMammalian Expression, Lentiviral, Synthetic Biology
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTerminal deoxynucleotidyl transferase
-
Alt nameTdT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2167
-
Mutationsynonymous mutation in D2, synonymous mutation in V414, endogenous HEK3 sequence added downstream of TdT gene
-
Entrez GeneDNTT (a.k.a. TDT)
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CMV Forward (Invitrogen, CGCAAATGGGCGGTAGGCGTG) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byChang Liu's lab (Addgene plasmid #126450)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid has also been grown in Invitrogen One Shot Stbl3 chemically competent E. coli.
Please visit https://doi.org/10.1101/2024.06.11.598561 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCKC017 was a gift from Chang Liu (Addgene plasmid # 226622 ; http://n2t.net/addgene:226622 ; RRID:Addgene_226622) -
For your References section:
A massively parallel in vivo assay of TdT mutants yields variants with altered nucleotide insertion biases. Carlson CK, Loveless TB, Milisavljevic M, Kelly PI, Mills JH, Tyo KEJ, Liu CC. bioRxiv [Preprint]. 2024 Jun 11:2024.06.11.598561. doi: 10.1101/2024.06.11.598561. 10.1101/2024.06.11.598561 PubMed 38915690