Skip to main content

pTBL3401 BtoApegRNA-sfGFP
(Plasmid #226667)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 226667 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    MTK0 PiggyBac cargo backbone
  • Backbone manufacturer
    Hana El-Samad Lab
  • Modifications to backbone
    We removed the mammalian marker gene.
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BtoA pegRNA
  • gRNA/shRNA sequence
    ACTGGGCCATCTATCATTGA
  • Species
    Synthetic
  • Promoter hU6

Cloning Information

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2021.11.05.467507 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTBL3401 BtoApegRNA-sfGFP was a gift from Chang Liu (Addgene plasmid # 226667 ; http://n2t.net/addgene:226667 ; RRID:Addgene_226667)
  • For your References section:

    Open-ended molecular recording of sequential cellular events into DNA. Loveless TB, Carlson CK, Dentzel Helmy CA, Hu VJ, Ross SK, Demelo MC, Murtaza A, Liang G, Ficht M, Singhai A, Pajoh-Casco MJ, Liu CC. Nat Chem Biol. 2025 Apr;21(4):512-521. doi: 10.1038/s41589-024-01764-5. Epub 2024 Nov 14. 10.1038/s41589-024-01764-5 PubMed 39543397