pTBL3401 BtoApegRNA-sfGFP
(Plasmid
#226667)
-
PurposePiggyBac cargo vector encoding B to A pegRNA marked with sfGFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 226667 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneMTK0 PiggyBac cargo backbone
-
Backbone manufacturerHana El-Samad Lab
-
Modifications to backboneWe removed the mammalian marker gene.
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBtoA pegRNA
-
gRNA/shRNA sequenceACTGGGCCATCTATCATTGA
-
SpeciesSynthetic
- Promoter hU6
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer hU6
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byJohn Dueber's lab (sfGFP was obtained from the MoClo Yeast Toolkit, Kit #1000000061), and Hana El-Samad (Mammalian Toolkit, Kit #1000000180).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2021.11.05.467507 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTBL3401 BtoApegRNA-sfGFP was a gift from Chang Liu (Addgene plasmid # 226667 ; http://n2t.net/addgene:226667 ; RRID:Addgene_226667) -
For your References section:
Open-ended molecular recording of sequential cellular events into DNA. Loveless TB, Carlson CK, Dentzel Helmy CA, Hu VJ, Ross SK, Demelo MC, Murtaza A, Liang G, Ficht M, Singhai A, Pajoh-Casco MJ, Liu CC. Nat Chem Biol. 2025 Apr;21(4):512-521. doi: 10.1038/s41589-024-01764-5. Epub 2024 Nov 14. 10.1038/s41589-024-01764-5 PubMed 39543397