pTBL3428 MTK234-LacO-BtoApegRNA
(Plasmid
#226669)
-
PurposeMTK234 part containing lac-inducible variant of the hU6 promoter driving a B to A pegRNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 226669 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneMTK234
-
Backbone manufacturerHana El-Samad Lab
-
Vector typeMammalian Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehU6-LacOS-BtoApegRNA
-
gRNA/shRNA sequenceACTGGGCCATCTATCATTGA
- Promoter hU6-LacOS
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ColE1
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byHana El-Samad (Mammalian Toolkit, Kit #1000000180).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2021.11.05.467507 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTBL3428 MTK234-LacO-BtoApegRNA was a gift from Chang Liu (Addgene plasmid # 226669 ; http://n2t.net/addgene:226669 ; RRID:Addgene_226669) -
For your References section:
Open-ended molecular recording of sequential cellular events into DNA. Loveless TB, Carlson CK, Dentzel Helmy CA, Hu VJ, Ross SK, Demelo MC, Murtaza A, Liang G, Ficht M, Singhai A, Pajoh-Casco MJ, Liu CC. Nat Chem Biol. 2025 Apr;21(4):512-521. doi: 10.1038/s41589-024-01764-5. Epub 2024 Nov 14. 10.1038/s41589-024-01764-5 PubMed 39543397