pCS2-hcar1-4-mKate2
(Plasmid
#226712)
-
Purposeoverexpression red fluorescent hcar1-4 protein in zebrafish larvae
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 226712 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCS2
- Backbone size w/o insert (bp) 4818
- Total vector size (bp) 5754
-
Vector typeUnspecified ; Zebrafish expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehcar1-4
-
Speciesdanio rerio
-
Insert Size (bp)1239
-
GenBank IDENSDARG00000087084
- Promoter SP6
-
Tag
/ Fusion Protein
- mKate2
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer atttaggtgacactataga
- 3′ sequencing primer tgccctccatgtacagcttc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS2-hcar1-4-mKate2 was a gift from Philipp Niethammer (Addgene plasmid # 226712 ; http://n2t.net/addgene:226712 ; RRID:Addgene_226712) -
For your References section:
Oxoeicosanoid signaling mediates early antimicrobial defense in zebrafish. Ma Y, Hui KL, Gelashvili Z, Niethammer P. Cell Rep. 2023 Jan 31;42(1):111974. doi: 10.1016/j.celrep.2022.111974. Epub 2023 Jan 10. 10.1016/j.celrep.2022.111974 PubMed 36640321