Skip to main content

pOGS539_GLuc
(Plasmid #226718)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 226718 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    OGS539
  • Backbone manufacturer
    Sigma-Aldrich
  • Backbone size w/o insert (bp) 6846
  • Total vector size (bp) 7673
  • Vector type
    Yeast Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Gaussia Luciferase
  • Alt name
    GLuc
  • Species
    Gaussia princeps
  • Insert Size (bp)
    827
  • GenBank ID
    FJ010198.1
  • Promoter pTEF1
  • Tags / Fusion Proteins
    • HA tag (N terminal on insert)
    • Mating factor alpha secretion signal (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CATATCACATAGGAAGCAACAG
  • 3′ sequencing primer CTACGATACCGATAGAGATGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    GenBank FJ010198.1

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOGS539_GLuc was a gift from Gautam Dantas (Addgene plasmid # 226718 ; http://n2t.net/addgene:226718 ; RRID:Addgene_226718)
  • For your References section:

    A yeast-based oral therapeutic delivers immune checkpoint inhibitors to reduce intestinal tumor burden. Rebeck ON, Wallace MJ, Prusa J, Ning J, Evbuomwan EM, Rengarajan S, Habimana-Griffin L, Kwak S, Zahrah D, Tung J, Liao J, Mahmud B, Fishbein SRS, Ramirez Tovar ES, Mehta R, Wang B, Gorelik MG, Helmink BA, Dantas G. Cell Chem Biol. 2024 Nov 16:S2451-9456(24)00452-5. doi: 10.1016/j.chembiol.2024.10.013. 10.1016/j.chembiol.2024.10.013 PubMed 39571582