pOGS539_GLuc-ns
(Plasmid
#226719)
-
PurposePlasmid enabling yeast-mediated expression of Gaussia luciferase (GLuc)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 226719 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneOGS539
-
Backbone manufacturerSigma-Aldrich
- Backbone size w/o insert (bp) 6846
- Total vector size (bp) 7418
-
Vector typeYeast Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGaussia Luciferase
-
Alt nameGLuc
-
SpeciesGaussia princeps
-
Insert Size (bp)572
-
GenBank IDFJ010198.1
- Promoter pTEF1
-
Tag
/ Fusion Protein
- HA tag (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CATATCACATAGGAAGCAACAG
- 3′ sequencing primer CTACGATACCGATAGAGATGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byGenBank FJ010198.1
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOGS539_GLuc-ns was a gift from Gautam Dantas (Addgene plasmid # 226719 ; http://n2t.net/addgene:226719 ; RRID:Addgene_226719) -
For your References section:
A yeast-based oral therapeutic delivers immune checkpoint inhibitors to reduce intestinal tumor burden. Rebeck ON, Wallace MJ, Prusa J, Ning J, Evbuomwan EM, Rengarajan S, Habimana-Griffin L, Kwak S, Zahrah D, Tung J, Liao J, Mahmud B, Fishbein SRS, Ramirez Tovar ES, Mehta R, Wang B, Gorelik MG, Helmink BA, Dantas G. Cell Chem Biol. 2024 Nov 16:S2451-9456(24)00452-5. doi: 10.1016/j.chembiol.2024.10.013. 10.1016/j.chembiol.2024.10.013 PubMed 39571582