pEXP1/Joseph2-Multitagged Plasmid
(Plasmid
#226724)
-
PurposeValidates the expression and detection of epitope-tagged proteins of interest in bacterial cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 226724 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEXP1
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepEXP1/Joseph2
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis, HA, Myc, GFP, Flag, V5
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEXP1/Joseph2-Multitagged Plasmid was a gift from Richard Cripps (Addgene plasmid # 226724 ; http://n2t.net/addgene:226724 ; RRID:Addgene_226724) -
For your References section:
pJoseph2: a family of plasmids as positive controls for bacterial protein expression, transfections, and western blots. Robinson E, Alonso EB, A Waters J, Bileckyj C, D House C, A Johnston C, M Cripps R. Biotechniques. 2024;76(7):299-309. doi: 10.1080/07366205.2024.2343609. Epub 2024 May 12. 10.1080/07366205.2024.2343609 PubMed 39185782