pAHW/Joseph2-Multitagged Plasmid
(Plasmid
#226725)
-
PurposeValidates the expression and detection of epitope-tagged proteins of interest in Drosophila cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 226725 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAHW
-
Backbone manufacturerDrosophila Genomics Resource Center
-
Vector typeInsect Expression ; Drosophila S2 cell expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepAHW/Joseph2
- Promoter Act5C
-
Tag
/ Fusion Protein
- HA, Myc, GFP, Flag, V5, 6xHis
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer GTTCAGGGGGAGGTGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAHW/Joseph2-Multitagged Plasmid was a gift from Richard Cripps (Addgene plasmid # 226725 ; http://n2t.net/addgene:226725 ; RRID:Addgene_226725) -
For your References section:
pJoseph2: a family of plasmids as positive controls for bacterial protein expression, transfections, and western blots. Robinson E, Alonso EB, A Waters J, Bileckyj C, D House C, A Johnston C, M Cripps R. Biotechniques. 2024;76(7):299-309. doi: 10.1080/07366205.2024.2343609. Epub 2024 May 12. 10.1080/07366205.2024.2343609 PubMed 39185782