Skip to main content

pAG392
(Plasmid #226749)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 226749 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCRISPRia-V2
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ATP13A1
  • gRNA/shRNA sequence
    GGGTAAAGCAGCCCGGCGAA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20
  • Entrez Gene
    ATP13A1 (a.k.a. ATP13A, CGI-152, FLJ31858, FLJ41786, FLJ43873, FLJ90317, KIAA1825, DKFZp761L1623)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please also see the paper Triaging of α-helical proteins to the mitochondrial outer membrane by distinct chaperone machinery based on substrate topology, Mol Cell . 2024 Mar 21;84(6):1101-1119.e9. doi: 10.1016/j.molcel.2024.01.028. Epub 2024 Feb 29. https://pubmed.ncbi.nlm.nih.gov/38428433/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAG392 was a gift from Jonathan Weissman (Addgene plasmid # 226749 ; http://n2t.net/addgene:226749 ; RRID:Addgene_226749)
  • For your References section:

    MTCH2 is a mitochondrial outer membrane protein insertase. Guna A, Stevens TA, Inglis AJ, Replogle JM, Esantsi TK, Muthukumar G, Shaffer KCL, Wang ML, Pogson AN, Jones JJ, Lomenick B, Chou TF, Weissman JS, Voorhees RM. Science. 2022 Oct 21;378(6617):317-322. doi: 10.1126/science.add1856. Epub 2022 Oct 20. 10.1126/science.add1856 PubMed 36264797