SMT503
(Plasmid
#226840)
-
PurposePlasmid that encodes a B. Subtilis lipase (BsLipA) gene fusion with N-terminal SNAP and C-Terminal eGFP under a T7 promoter. Compatible with PURExpress for in vitro transcription/translation. Chloramp
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 226840 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSB1C3
-
Backbone manufactureriGEM
- Backbone size w/o insert (bp) 2034
- Total vector size (bp) 3894
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLipase A
-
Alt nameBsLipA
-
SpeciesB. subtilis
-
Insert Size (bp)1860
-
MutationR33Q, D34N, K35D, K112D, M134D, Y139C, I157M
-
GenBank IDM74010
- Promoter T7
-
Tags
/ Fusion Proteins
- SNAP (N terminal on insert)
- eGFP (C terminal on insert)
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer ACCTCTTACGTGCCCGATCAAC
- 3′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The SMT502 plasmid was generated with assistance from Daria Passow, Stanford University, who generated the Golden Gate acceptor vector.
Please visit https://doi.org/10.1101/2024.03.01.583031 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SMT503 was a gift from Polly Fordyce (Addgene plasmid # 226840 ; http://n2t.net/addgene:226840 ; RRID:Addgene_226840) -
For your References section:
FACS-Sortable Triple Emulsion Picoreactors for Screening Reactions in Biphasic Environments. Thompson S, Zhang Y, Yang Z, Nichols L, Fordyce PM. Adv Mater Interfaces. 2025 Feb 3;12(3):2400403. doi: 10.1002/admi.202400403. Epub 2024 Dec 4. 10.1002/admi.202400403 PubMed 40831677