Skip to main content

SMT503 - S77A
(Plasmid #226842)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 226842 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSB1C3
  • Backbone manufacturer
    iGEM
  • Backbone size w/o insert (bp) 2034
  • Total vector size (bp) 3894
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Lipase A
  • Alt name
    BsLipA
  • Species
    B. subtilis
  • Insert Size (bp)
    1860
  • Mutation
    R33Q, D34N, K35D, S77A, K112D, M134D, Y139C, I157M
  • GenBank ID
    M74010
  • Promoter T7
  • Tags / Fusion Proteins
    • SNAP (N terminal on insert)
    • eGFP (C terminal on insert)

Cloning Information

  • Cloning method Golden Gate
  • 5′ sequencing primer ACCTCTTACGTGCCCGATCAAC
  • 3′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The SMT502-S77A plasmid was generated with assistance from Daria Passow, Stanford University, who generated the Golden Gate acceptor vector.

Please visit https://doi.org/10.1101/2024.03.01.583031 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SMT503 - S77A was a gift from Polly Fordyce (Addgene plasmid # 226842 ; http://n2t.net/addgene:226842 ; RRID:Addgene_226842)
  • For your References section:

    FACS-Sortable Triple Emulsion Picoreactors for Screening Reactions in Biphasic Environments. Thompson S, Zhang Y, Yang Z, Nichols LA, Fordyce PM. Adv Mater Interfaces 2024, 12 (3), 2400403. doi: 10.1002/admi.202400403. 10.1002/admi.202400403