pAH33
(Plasmid
#226850)
-
PurposeTo constitutively overexpress Opa1 from the safe harbor locus Rosa26 in MEF
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 226850 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepR26-CMVconst
-
Backbone manufacturerInvitrogen (Life Technologies)
- Backbone size w/o insert (bp) 7941
- Total vector size (bp) 11834
-
Vector typeMouse Targeting, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOpa1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2880
-
Entrez GeneOpa1 (a.k.a. 1200011N24Rik, lilr3, mKIAA0567)
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGGGGATGCTAGCATGTGGCGAGCAGGTC
- 3′ sequencing primer CCGCCTGCAGGTCACTTCTCCTGGTGAAGAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAH33 was a gift from Luke Chao (Addgene plasmid # 226850 ; http://n2t.net/addgene:226850 ; RRID:Addgene_226850) -
For your References section:
In situ architecture of Opa1-dependent mitochondrial cristae remodeling. Fry MY, Navarro PP, Hakim P, Ananda VY, Qin X, Landoni JC, Rath S, Inde Z, Lugo CM, Luce BE, Ge Y, McDonald JL, Ali I, Ha LL, Kleinstiver BP, Chan DC, Sarosiek KA, Chao LH. EMBO J. 2024 Feb;43(3):391-413. doi: 10.1038/s44318-024-00027-2. Epub 2024 Jan 15. 10.1038/s44318-024-00027-2 PubMed 38225406