pCBE-dGFP-gRNA
(Plasmid
#226862)
-
PurposeHuman gRNA expression vector targeting the Y93H mutation of non-fluorescent EGFP in plasmid pCBE-dGFP; for use with CBEs
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 226862 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneMLM3636
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSp-gRNA
-
gRNA/shRNA sequenceAGGTCACGTACAGGAGCGCA
-
SpeciesOther
- Promoter hU6
Cloning Information
- Cloning method Unknown
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCBE-dGFP-gRNA was a gift from Alexis Komor (Addgene plasmid # 226862 ; http://n2t.net/addgene:226862 ; RRID:Addgene_226862) -
For your References section:
Genome editing with programmable base editors in human cells. Osgood NRB, Zawalick NM, Sawyer CB, Cowan QT, Gu S, Mawson SJ, Ranzau BL, Li L, Gymrek M, Goren A, Komor AC. Methods Enzymol. 2025;712:351-404. doi: 10.1016/bs.mie.2025.01.001. Epub 2025 Feb 5. 10.1016/bs.mie.2025.01.001 PubMed 40121079