pUC19-U6-SpCas9_gRNA-OPA1-del_exon5-gRNA1a_(CJT90)
(Plasmid
#226989)
-
PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-del_exon5 cell line via nuclease mediate excision, gRNA 1a must be used with gRNA 2a or 2b
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 226989 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneBPK1520
-
Backbone manufacturerKeith Joung, Addgene plasmid #65777
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpCas9 gRNA 1a to create OPA1-del_exon5
-
Alt nameCJT90
-
Alt namepUC19-U6-SpCas9_gRNA-OPA1-del_exon5-gRNA1a_(CJT90)
-
gRNA/shRNA sequenceGCTCATTGTGAACTCGTGGCA
-
SpeciesSynthetic
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer oS280-CAGGGTTATTGTCTCATGAGCGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC19-U6-SpCas9_gRNA-OPA1-del_exon5-gRNA1a_(CJT90) was a gift from Benjamin Kleinstiver (Addgene plasmid # 226989 ; http://n2t.net/addgene:226989 ; RRID:Addgene_226989) -
For your References section:
In situ architecture of Opa1-dependent mitochondrial cristae remodeling. Fry MY, Navarro PP, Hakim P, Ananda VY, Qin X, Landoni JC, Rath S, Inde Z, Lugo CM, Luce BE, Ge Y, McDonald JL, Ali I, Ha LL, Kleinstiver BP, Chan DC, Sarosiek KA, Chao LH. EMBO J. 2024 Feb;43(3):391-413. doi: 10.1038/s44318-024-00027-2. Epub 2024 Jan 15. 10.1038/s44318-024-00027-2 PubMed 38225406