Skip to main content

AAVS1-TRE-U2AF2-TurboID-HA-rtTA
(Plasmid #226997)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 226997 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    AAVS1-TRE-TurboID-HA-rtTA
  • Backbone size w/o insert (bp) 11031
  • Total vector size (bp) 12440
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    U2 small nuclear RNA auxiliary factor 2
  • Alt name
    U2AF2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1425
  • Entrez Gene
    U2AF2 (a.k.a. DEVDFB, U2AF65)
  • Tag / Fusion Protein
    • TurboID-HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site BstBI (not destroyed)
  • 5′ sequencing primer CACGTCTCGAGCTCCCTATC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: This plasmid contains a D404V mutation in U2AF65. This mutation is not expected to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVS1-TRE-U2AF2-TurboID-HA-rtTA was a gift from Bruno Dallagiovanna (Addgene plasmid # 226997 ; http://n2t.net/addgene:226997 ; RRID:Addgene_226997)
  • For your References section:

    Construction of a proximity labeling vector to identify protein-protein interactions in human stem cells. Gomes-Junior R, Moreira CMDN, Dallagiovanna B. PLoS One. 2025 May 30;20(5):e0324779. doi: 10.1371/journal.pone.0324779. eCollection 2025. 10.1371/journal.pone.0324779 PubMed 40445938