Skip to main content

pAAV-CMVenh synapsin-intron-aSYNUCLEIN A53T
(Plasmid #227004)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 227004 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Wilson
  • Backbone size w/o insert (bp) 4959
  • Total vector size (bp) 5398
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    alpha synuclein A53T mutant
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    423
  • Mutation
    A53T
  • Entrez Gene
    SNCA (a.k.a. NACP, PARK1, PARK4, PD1)
  • Promoter CMVenh synapsin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer GGTTACAAGACAGGTTTAAGGAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CMVenh synapsin-intron-aSYNUCLEIN A53T was a gift from Veerle Baekelandt (Addgene plasmid # 227004 ; http://n2t.net/addgene:227004 ; RRID:Addgene_227004)
  • For your References section:

    Development of an Alpha-synuclein Based Rat Model for Parkinson's Disease via Stereotactic Injection of a Recombinant Adeno-associated Viral Vector. Van der Perren A, Casteels C, Van Laere K, Gijsbers R, Van den Haute C, Baekelandt V. J Vis Exp. 2016 Feb 28;(108):53670. doi: 10.3791/53670. 10.3791/53670 PubMed 26967677