TadA-8e-eIscBn-N-HMG-D
(Plasmid
#227143)
-
PurposeVector encoding human codon-optimized enhanced-activity nOgeuIscB fusion with TadA8e and HMG-D domain in N terminus driven by CMV promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 227143 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namebpNLS-HMG-D-linker-TadA-8e-linker-nOgeuIscB-v3-bpNLS
-
SpeciesSynthetic
-
MutationD96R/E84R/V159R/H339A
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGAGCGACAAACCGAAACGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TadA-8e-eIscBn-N-HMG-D was a gift from Dali Li (Addgene plasmid # 227143 ; http://n2t.net/addgene:227143 ; RRID:Addgene_227143) -
For your References section:
Engineering IscB to develop highly efficient miniature editing tools in mammalian cells and embryos. Xue N, Hong D, Zhang D, Wang Q, Zhang S, Yang L, Chen X, Li Y, Han H, Hu C, Liu M, Song G, Guan Y, Wang L, Zhu Y, Li D. Mol Cell. 2024 Aug 22;84(16):3128-3140.e4. doi: 10.1016/j.molcel.2024.07.007. Epub 2024 Aug 2. 10.1016/j.molcel.2024.07.007 PubMed 39096898