pAAV-hSyn1-DIO-SEP-GluA2
(Plasmid
#227233)
-
PurposeLarge cargo capacity AAV that expresses SEP tagged AMPA receptor subunit GluA2 in neurons expressing Cre recombinase
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 227233 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerAgilent
- Backbone size w/o insert (bp) 3996
- Total vector size (bp) 7374
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsGrow at 30C for a short time to avoid ITR deletions
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSEP-GluA2
-
Alt namesuperecliptic pHluorin-tagged AMPA receptor GluA2 subunit
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)3303
-
Entrez GeneGria2 (a.k.a. GluA2, GluR-K2, GluR2, gluR-B)
- Promoter hSyn1
-
Tag
/ Fusion Protein
- superecliptic pHluorin (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TGCGGCGCCGGCGACTCAGCGCTGCCTCAGTCTGCGGTGGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bysuperecliptic pHluorin was based on Transmission of Olfactory Information between Three Populations of Neurons in the Antennal Lobe of the Fly. Ng M, Roorda Rd, Lima Sq, Zemelman Bv, Morcillo P, Miesenböck G. (2002). Neuron, 36(3) , 463-474. doi: 10.1016/s0896-6273(02)00975-3.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.07.20.549908 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn1-DIO-SEP-GluA2 was a gift from Richard Huganir (Addgene plasmid # 227233 ; http://n2t.net/addgene:227233 ; RRID:Addgene_227233) -
For your References section:
Calcium-permeable AMPA receptors govern PV neuron feature selectivity. Hong I, Kim J, Hainmueller T, Kim DW, Keijser J, Johnson RC, Park SH, Limjunyawong N, Yang Z, Cheon D, Hwang T, Agarwal A, Cholvin T, Krienen FM, McCarroll SA, Dong X, Leopold DA, Blackshaw S, Sprekeler H, Bergles DE, Bartos M, Brown SP, Huganir RL. Nature. 2024 Nov;635(8038):398-405. doi: 10.1038/s41586-024-08027-2. Epub 2024 Oct 2. 10.1038/s41586-024-08027-2 PubMed 39358515