pk335-NT-1mer-gRNA
(Plasmid
#227500)
-
Purposenon-targeting control guide
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 227500 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepk335-BFP
-
Vector typeCRISPR
-
Selectable markersNeomycin (select with G418) ; TagBFP
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNon-targeting gRNA
-
gRNA/shRNA sequenceCCATTGGCAGGCTCCTACCA
-
SpeciesM. musculus (mouse), Synthetic
Cloning Information
- Cloning method Other
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pk335-NT-1mer-gRNA was a gift from Joanna Wysocka (Addgene plasmid # 227500 ; http://n2t.net/addgene:227500 ; RRID:Addgene_227500) -
For your References section:
Long-range regulation of transcription scales with genomic distance in a gene-specific manner. Jensen CL, Chen LF, Swigut T, Crocker OJ, Yao D, Bassik MC, Ferrell JE Jr, Boettiger AN, Wysocka J. Mol Cell. 2025 Jan 16;85(2):347-361.e7. doi: 10.1016/j.molcel.2024.10.021. Epub 2024 Dec 2. 10.1016/j.molcel.2024.10.021 PubMed 39626660