pPB-CAG-shControl-mCherry-CAAX
(Plasmid
#227689)
-
PurposeMembrane tethered mCherry and scramble of shRNA targeting Atg7
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 227689 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepPB
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namescrambled shRNA control
-
gRNA/shRNA sequenceGTTGCGGTTATGAATAGTACT
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.04.09.536178 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPB-CAG-shControl-mCherry-CAAX was a gift from Cagla Eroglu (Addgene plasmid # 227689 ; http://n2t.net/addgene:227689 ; RRID:Addgene_227689) -
For your References section:
PD-linked LRRK2 G2019S mutation impairs astrocyte morphology and synapse maintenance via ERM hyperphosphorylation. Wang S, Baumert R, Séjourné G, Bindu DS, Dimond K, Sakers K, Vazquez L, Moore JL, Tan CX, Takano T, Rodriguez MP, Brose N, Bradley L, Lessing R, Soderling SH, La Spada AR, Eroglu C. eLife 2025 [Reviewed Preprint] 14:RP107556. doi: https://doi.org/10.7554/eLife.107556.1 10.7554/eLife.107556.1