Skip to main content

pICH47742::p35S-ePEmax3::tEURb7
(Plasmid #227692)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 227692 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pICH47742
  • Vector type
    Plant Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    The depositing lab recommends using 10beta strain for expression.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ePEmax3 being driven by long CaMV 35S (p35S) and terminated by a dual terminator (EURb7).
  • Species
    Synthetic
  • Insert Size (bp)
    9171
  • Promoter CaMV 35S

Cloning Information

  • Cloning method Golden Gate
  • 5′ sequencing primer GGTGTAAACAAATTGACGCTTAGA
  • 3′ sequencing primer CTCTTAGGTTTACCCGCCAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pICH47742::p35S-ePEmax3::tEURb7 was a gift from Jae-Yean Kim (Addgene plasmid # 227692 ; http://n2t.net/addgene:227692 ; RRID:Addgene_227692)
  • For your References section:

    Optimized dicot prime editing enables heritable desired edits in tomato and Arabidopsis. Vu TV, Nguyen NT, Kim J, Song YJ, Nguyen TH, Kim JY. Nat Plants. 2024 Sep 6. doi: 10.1038/s41477-024-01786-w. 10.1038/s41477-024-01786-w PubMed 39242983