Skip to main content

pC368: pAAV.CMV-Cas13e-VEGFA sgRNA2
(Plasmid #227800)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 227800 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV.CMV-BGHpA
  • Backbone manufacturer
    VectorBuilder
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    U6-VEGFA sgRNA 2
  • Alt name
    VEGFA
  • gRNA/shRNA sequence
    cacttcgtgatgattctgccctcctccttc
  • Species
    Synthetic
  • Insert Size (bp)
    375
  • Entrez Gene
    Vegfa (a.k.a. L-VEGF, Vegf, Vpf)

Gene/Insert 2

  • Gene/Insert name
    Cas13e
  • Alt name
    Cas13X.1, Cas13bt3
  • gRNA/shRNA sequence
    -
  • Species
    Ruminococcus flavefaciens XPD3002
  • Insert Size (bp)
    2403
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • NLS (N terminal on insert)
    • HA (C terminal on insert)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pC368: pAAV.CMV-Cas13e-VEGFA sgRNA2 was a gift from Guei-Sheung Liu (Addgene plasmid # 227800 ; http://n2t.net/addgene:227800 ; RRID:Addgene_227800)
  • For your References section:

    Characterization of RNA editing and gene therapy with a compact CRISPR-Cas13 in the retina. Kumar S, Hsiao YW, Wong VHY, Aubin D, Wang JH, Lisowski L, Rakoczy EP, Li F, Alarcon-Martinez L, Gonzalez-Cordero A, Bui BV, Liu GS. Proc Natl Acad Sci U S A. 2024 Nov 5;121(45):e2408345121. doi: 10.1073/pnas.2408345121. Epub 2024 Oct 30. 10.1073/pnas.2408345121 PubMed 39475642