pC369: pAAV.CMV-Cas13e-VEGFA sgRNA3
(Plasmid
#227801)
-
PurposePlasmid expressing active Cas13e with VEGFA mRNA targeting gRNA3
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 227801 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV.CMV-BGHpA
-
Backbone manufacturerVectorBuilder
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameU6-VEGFA sgRNA 3
-
Alt namevegfa
-
gRNA/shRNA sequencetctgcattcacatttgttgtgctgtaggaa
-
SpeciesSynthetic
-
Insert Size (bp)375
-
Entrez GeneVegfa (a.k.a. L-VEGF, Vegf, Vpf)
Gene/Insert 2
-
Gene/Insert nameCas13e
-
Alt nameCas13X.1, Cas13bt3
-
gRNA/shRNA sequence-
-
SpeciesRuminococcus flavefaciens XPD3002
-
Insert Size (bp)2403
-
Tags
/ Fusion Proteins
- NLS (C terminal on insert)
- NLS (N terminal on insert)
- HA (C terminal on insert)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC369: pAAV.CMV-Cas13e-VEGFA sgRNA3 was a gift from Guei-Sheung Liu (Addgene plasmid # 227801 ; http://n2t.net/addgene:227801 ; RRID:Addgene_227801) -
For your References section:
Characterization of RNA editing and gene therapy with a compact CRISPR-Cas13 in the retina. Kumar S, Hsiao YW, Wong VHY, Aubin D, Wang JH, Lisowski L, Rakoczy EP, Li F, Alarcon-Martinez L, Gonzalez-Cordero A, Bui BV, Liu GS. Proc Natl Acad Sci U S A. 2024 Nov 5;121(45):e2408345121. doi: 10.1073/pnas.2408345121. Epub 2024 Oct 30. 10.1073/pnas.2408345121 PubMed 39475642