pAAV-CMV -HA-Luciferase
(Plasmid
#227802)
-
Purposeexpressing HA tag and the coding sequence of luciferase by the constitutive CMV promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 227802 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV-CMV-MCS-GFP-noATG
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHA-Luciferase
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ccagatatacgcgttgacattgat (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.06.10.597311 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CMV -HA-Luciferase was a gift from Yuxuan Guo (Addgene plasmid # 227802 ; http://n2t.net/addgene:227802 ; RRID:Addgene_227802) -
For your References section:
Myocardial infarction creates a critical time window for AAV-based cardiac gene transfer. Chen G, Zhang Y, Liu Z, Wu J, Chen Z, Yang L, Zhang J, Wu Y, Li J, Bai B, Lv Z, Gao F, Dong E, Guo Y. Fundam Res. 2025 Jun 30. doi: https://doi.org/10.1016/j.fmre.2025.06.012 10.1016/j.fmre.2025.06.012