pAAV-Tnnt2 -Atp2a2-HA
(Plasmid
#227804)
-
Purposecardiomyocytes-specific plasmid with Tnnt2 promotor, expressing the coding sequence of mouse Atp2a2 and a HA tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 227804 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV-Tnnt2-Strabd-GFP
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAtp2a2-HA
-
SpeciesM. musculus (mouse)
-
GenBank IDNM_001110140.3
-
Entrez GeneAtp2a2 (a.k.a. 9530097L16Rik, D5Wsu150e, SERCA2, SERCA2B, Serca2a, mKIAA4195)
- Promoter Tnnt2
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TACCAGGGTAATGGGGATCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.06.10.597311 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Tnnt2 -Atp2a2-HA was a gift from Yuxuan Guo (Addgene plasmid # 227804 ; http://n2t.net/addgene:227804 ; RRID:Addgene_227804) -
For your References section:
Myocardial infarction creates a critical time window for AAV-based cardiac gene transfer. Chen G, Zhang Y, Liu Z, Wu J, Chen Z, Yang L, Zhang J, Wu Y, Li J, Bai B, Lv Z, Gao F, Dong E, Guo Y. Fundam Res. 2025 Jun 30;5(6):2993-3000. doi: 10.1016/j.fmre.2025.06.012. eCollection 2025 Nov. 10.1016/j.fmre.2025.06.012 PubMed 41467029