pMCB320 sgCdkn1a.1
(Plasmid
#227945)
-
PurposesgRNA targeting Cdkn1a, mCherry, puromycin resistance, Mammalian expression, Mouse targeting, lentiviral, CRISPR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 227945 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMCB320
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCdkn1a.1
-
Alt namep21
-
gRNA/shRNA sequenceGGAACAGGTCGGACATCACC
-
SpeciesM. musculus (mouse)
-
Entrez GeneCdkn1a (a.k.a. CAP20, CDKI, CIP1, Cdkn1, P21, SDI1, Waf1, mda6, p21Cip1, p21WAF)
- Promoter mouse U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BstxI (not destroyed)
- 3′ cloning site BlpI (not destroyed)
- 5′ sequencing primer CAGCACAAAAGGAAACTCACC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMCB320 was generated in the Bassik lab and we used as a vector.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.09.17.612743 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMCB320 sgCdkn1a.1 was a gift from Laura Attardi (Addgene plasmid # 227945 ; http://n2t.net/addgene:227945 ; RRID:Addgene_227945) -
For your References section:
Integrative multiomic approaches reveal ZMAT3 and p21 as conserved hubs in the p53 tumor suppression network. Boutelle AM, Mabene AR, Yao D, Xu H, Wang M, Tang YJ, Lopez SS, Sinha S, Demeter J, Cheng R, Benard BA, McCrea EM, Valente LJ, Drainas AP, Fischer M, Majeti R, Petrov DA, Jackson PK, Yang F, Winslow MM, Bassik MC, Attardi LD. Cell Death Differ. 2025 Apr 22. doi: 10.1038/s41418-025-01513-8. 10.1038/s41418-025-01513-8 PubMed 40263541