pMDC32B-B/c
(Plasmid
#227963)
-
PurposeExpression plasmid with a ccdB cassette flanked with two inverted BsaI restriction sites. Allows the high throughput cloning of cloning inserts flanked with compatible 4-nt overhangs.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 227963 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMDC32
- Backbone size w/o insert (bp) 10133
- Total vector size (bp) 11602
-
Vector typePlant Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Kanamycin, 25 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameB/c
-
Alt nameBsaI-ccdB
-
Insert Size (bp)1469
- Promoter 35S
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer CGCCAAGCTATCAAACAAGTTTGTA
- 3′ sequencing primer ACCACTTTGTACAAGAAAGCTGGGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.12.18.629176 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMDC32B-B/c was a gift from Alberto Carbonell (Addgene plasmid # 227963 ; http://n2t.net/addgene:227963 ; RRID:Addgene_227963) -
For your References section:
Syn-tasiR-VIGS: virus-based targeted RNAi in plants by synthetic trans-acting small interfering RNAs derived from minimal precursors. Cisneros AE, Alarcia A, Llorens-Gamez JJ, Puertes A, Juarez-Molina M, Primc A, Carbonell A. Nucleic Acids Res. 2025 Feb 27;53(5):gkaf183. doi: 10.1093/nar/gkaf183. 10.1093/nar/gkaf183 PubMed 40105245