Skip to main content

pMDC32B-AtmiR173aTS-B/c
(Plasmid #227965)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 227965 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMDC32
  • Total vector size (bp) 11639
  • Vector type
    Plant Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Kanamycin, 25 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    B/c
  • Alt name
    BsaI-ccdB
  • Insert Size (bp)
    1469
  • Promoter None

Cloning Information for Gene/Insert 1

  • Cloning method Golden Gate
  • 5′ sequencing primer CGCCAAGCTATCAAACAAGTTTGTA
  • 3′ sequencing primer ACCACTTTGTACAAGAAAGCTGGGT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    AtmiR173aTS
  • Alt name
    Arabidopsis thaliana microRNA 173a target site
  • Species
    A. thaliana (mustard weed)
  • Promoter 35S

Cloning Information for Gene/Insert 2

  • Cloning method Golden Gate
  • 5′ sequencing primer CGCCAAGCTATCAAACAAGTTTGTA
  • 3′ sequencing primer ACCACTTTGTACAAGAAAGCTGGGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.12.18.629176 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMDC32B-AtmiR173aTS-B/c was a gift from Alberto Carbonell (Addgene plasmid # 227965 ; http://n2t.net/addgene:227965 ; RRID:Addgene_227965)
  • For your References section:

    Syn-tasiR-VIGS: virus-based targeted RNAi in plants by synthetic trans-acting small interfering RNAs derived from minimal precursors. Cisneros AE, Alarcia A, Llorens-Gamez JJ, Puertes A, Juarez-Molina M, Primc A, Carbonell A. Nucleic Acids Res. 2025 Feb 27;53(5):gkaf183. doi: 10.1093/nar/gkaf183. 10.1093/nar/gkaf183 PubMed 40105245