NST1_pOpOn2.1
              
              
                (Plasmid
                
                #228065)
              
            
            
            
          - 
            PurposeExpresses NST1 in different cell types in Arabidopsis thaliana upon induction with dexamethasone.
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 228065 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepOpOn2.1
 - 
              Backbone manufacturerDr. Markéta Šámalová
 - Backbone size w/o insert (bp) 18688
 - Total vector size (bp) 19786
 - 
              Vector typePlant Expression ; Dexamethasone inducible vector
 - 
                Selectable markersKanamycin for plants
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Spectinomycin, 50 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
              Growth instructionsUse 50 µg/ml Spectinomycin selection for bacteria and 25 µg/ml Kanamycin selection for plants
 - 
            Copy numberUnknown
 
Gene/Insert
- 
                Gene/Insert nameNAC SECONDARY WALL THICKENING PROMOTING FACTOR1, NST1
 - 
                  Alt nameNST1
 - 
                    SpeciesA. thaliana (mustard weed)
 - 
                  Insert Size (bp)1098
 - 
                        Entrez GeneNST1 (a.k.a. AT2G46770, ANAC043, Arabidopsis NAC domain containing protein 43, EMBRYO DEFECTIVE 2301, F19D11.5, NAC SECONDARY WALL THICKENING PROMOTING FACTOR1, NAC SECONDARY WALL THICKENING PROMOTING FACTOR1)
 - Promoter CaMV35S for LhGR and pOp6-minimal CaMV35S for NST1
 
Cloning Information
- Cloning method Gateway Cloning
 - 5′ sequencing primer GCAAGACCCTTCCTCTATATAAGG
 - 3′ sequencing primer GCAGGACTCTAGTGGATCCC (Common Sequencing Primers)
 
Resource Information
- 
            A portion of this plasmid was derived from a plasmid made byDr. Markéta Šámalová originally generated this vector and deposited it into NASC stock centre. We purchased it from NASC (2109482) and cloned full length NST1 into it.
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
NST1_pOpOn2.1 was a gift from Charles Anderson (Addgene plasmid # 228065 ; http://n2t.net/addgene:228065 ; RRID:Addgene_228065) - 
                
For your References section:
NST3 induces ectopic transdifferentiation, forming secondary walls with diverse patterns and composition in Arabidopsis thaliana. Tamadaddi C, Choi J, Ghasemi M, Kim SH, Gomez ED, Gomez EW, Anderson CT. Ann Bot. 2024 Aug 30:mcae153. doi: 10.1093/aob/mcae153. 10.1093/aob/mcae153 PubMed 39212164