Skip to main content

Pconst-CFP--Pconst-YFP
(Plasmid #228100)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 228100 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    UA_66
  • Backbone manufacturer
    Zaslaver Collection
  • Backbone size w/o insert (bp) 3000
  • Total vector size (bp) 5686
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    CFP & YFP
  • Species
    Synthetic
  • Promoter constitutive & constitutive

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGCAATTCCGACGTCTAAGA
  • 3′ sequencing primer GAACACCTGAGACAACTTGT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Backbone from Zaslaver 2006 paper

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Pconst-CFP--Pconst-YFP was a gift from Mary Dunlop (Addgene plasmid # 228100 ; http://n2t.net/addgene:228100 ; RRID:Addgene_228100)
  • For your References section:

    Evaluating the predictive power of combined gene expression dynamics from single cells on antibiotic survival. Alnahhas RN, Andreani V, Dunlop MJ. mSystems. 2025 May 20:e0158824. doi: 10.1128/msystems.01588-24. 10.1128/msystems.01588-24 PubMed 40391890