Pconst-CFP--Pconst-YFP
(Plasmid
#228100)
-
Purposeconstitutive promoter driving expression of CFP reporter and constitutive promoter driving expression of YFP reporter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 228100 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneUA_66
-
Backbone manufacturerZaslaver Collection
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 5686
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCFP & YFP
-
SpeciesSynthetic
- Promoter constitutive & constitutive
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGCAATTCCGACGTCTAAGA
- 3′ sequencing primer GAACACCTGAGACAACTTGT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byBackbone from Zaslaver 2006 paper
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Pconst-CFP--Pconst-YFP was a gift from Mary Dunlop (Addgene plasmid # 228100 ; http://n2t.net/addgene:228100 ; RRID:Addgene_228100) -
For your References section:
Evaluating the predictive power of combined gene expression dynamics from single cells on antibiotic survival. Alnahhas RN, Andreani V, Dunlop MJ. mSystems. 2025 May 20:e0158824. doi: 10.1128/msystems.01588-24. 10.1128/msystems.01588-24 PubMed 40391890