pLV EF1alpha INTS4 K26/27A IRES Cherry
(Plasmid
#228111)
-
PurposeLentiviral expression of human INTS4 K26/27A
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 228111 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLV EF1alpha MCS IRES Cherry
- Backbone size w/o insert (bp) 8911
- Total vector size (bp) 11802
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameINTS4
-
SpeciesH. sapiens (human)
-
MutationMutated Lysine 26 and 27 to Alanine
-
Entrez GeneINTS4 (a.k.a. INT4, MST093)
- Promoter EF 1alpha
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ATGGCGGCGCACCTTAAGAAGCGGGTTTATGAGGAATTCACG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://pubmed.ncbi.nlm.nih.gov/38903099/ for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV EF1alpha INTS4 K26/27A IRES Cherry was a gift from Tom Misteli (Addgene plasmid # 228111 ; http://n2t.net/addgene:228111 ; RRID:Addgene_228111) -
For your References section:
Identification of molecular determinants of gene-specific bursting patterns by high-throughput imaging screens. Sood V, Holewinski R, Andresson T, Larson DR, Misteli T. Mol Cell. 2025 Mar 6;85(5):913-928.e8. doi: 10.1016/j.molcel.2025.01.022. Epub 2025 Feb 19. 10.1016/j.molcel.2025.01.022 PubMed 39978338