pGH020 sgControl (GEA)
(Plasmid
#228193)
-
PurposeSafe targeting sgRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 228193 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGH020
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSafe targeting sgRNA
-
gRNA/shRNA sequenceGACCATGGAACTCACAAAAA
-
SpeciesM. musculus (mouse)
- Promoter human U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer CAAGGCTGTTAGAGAGATAATTGGA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byBassik lab; pGH020 was generated in the Bassik lab and we used as a vector.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.09.17.612743 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGH020 sgControl (GEA) was a gift from Laura Attardi (Addgene plasmid # 228193 ; http://n2t.net/addgene:228193 ; RRID:Addgene_228193) -
For your References section:
Integrative multiomic approaches reveal ZMAT3 and p21 as conserved hubs in the p53 tumor suppression network. Boutelle AM, Mabene AR, Yao D, Xu H, Wang M, Tang YJ, Lopez SS, Sinha S, Demeter J, Cheng R, Benard BA, McCrea EM, Valente LJ, Drainas AP, Fischer M, Majeti R, Petrov DA, Jackson PK, Yang F, Winslow MM, Bassik MC, Attardi LD. Cell Death Differ. 2025 Apr 22. doi: 10.1038/s41418-025-01513-8. 10.1038/s41418-025-01513-8 PubMed 40263541