pET28a-T4uvsW
(Plasmid
#228201)
-
PurposeExpression in BL21(DE3) of T4 3' to 5' helicase/single-strand DNA annealase
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 228201 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepET28a
-
Backbone manufacturerEMD Biosciences
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameuvsW
-
SpeciesEscherichia phage T4
-
GenBank IDNC_000866.4
- Promoter T7
-
Tag
/ Fusion Protein
- hexahistidine and 10 amino acid linker (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: This plasmid contains a S477D mutation in uvsW. This mutation is not known to impact plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28a-T4uvsW was a gift from Stephen Benkovic (Addgene plasmid # 228201 ; http://n2t.net/addgene:228201 ; RRID:Addgene_228201) -
For your References section:
The T4 phage UvsW protein contains both DNA unwinding and strand annealing activities. Nelson SW, Benkovic SJ. J Biol Chem. 2007 Jan 5;282(1):407-16. doi: 10.1074/jbc.M608153200. Epub 2006 Nov 8. 10.1074/jbc.M608153200 PubMed 17092935