Skip to main content

pET28a-T4uvsW
(Plasmid #228201)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 228201 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET28a
  • Backbone manufacturer
    EMD Biosciences
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    uvsW
  • Species
    Escherichia phage T4
  • GenBank ID
    NC_000866.4
  • Promoter T7
  • Tag / Fusion Protein
    • hexahistidine and 10 amino acid linker (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: This plasmid contains a S477D mutation in uvsW. This mutation is not known to impact plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28a-T4uvsW was a gift from Stephen Benkovic (Addgene plasmid # 228201 ; http://n2t.net/addgene:228201 ; RRID:Addgene_228201)
  • For your References section:

    The T4 phage UvsW protein contains both DNA unwinding and strand annealing activities. Nelson SW, Benkovic SJ. J Biol Chem. 2007 Jan 5;282(1):407-16. doi: 10.1074/jbc.M608153200. Epub 2006 Nov 8. 10.1074/jbc.M608153200 PubMed 17092935