Skip to main content

pET-Impact-T4gp61(I342G)
(Plasmid #228208)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 228208 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET-Impact
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    61
  • Species
    Escherichia phage T4
  • Mutation
    Mutated isoleucine 342 to glycine (I342G), improves thiol-induced self-cleavage of the intein-chitin binding domain tag
  • Entrez Gene
    61 (a.k.a. T4p033)
  • Promoter T7
  • Tag / Fusion Protein
    • Sce VMA intein-chitin binding domain (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (unknown if destroyed)
  • 3′ cloning site SapI (destroyed during cloning)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-Impact-T4gp61(I342G) was a gift from Stephen Benkovic (Addgene plasmid # 228208 ; http://n2t.net/addgene:228208 ; RRID:Addgene_228208)
  • For your References section:

    A zinc ribbon protein in DNA replication: primer synthesis and macromolecular interactions by the bacteriophage T4 primase. Valentine AM, Ishmael FT, Shier VK, Benkovic SJ. Biochemistry. 2001 Dec 18;40(50):15074-85. doi: 10.1021/bi0108554. 10.1021/bi0108554 PubMed 11735390