pTBY1-T4gp61/41 fusion
(Plasmid
#228210)
-
PurposeExpression in BL21(DE3) of T4 primase and helicase fusion with 24 amino acid linker
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 228210 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTBY1
-
Backbone manufacturerNew England BioLabs
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name61/41
-
SpeciesEscherichia phage T4
- Promoter T7
-
Tag
/ Fusion Protein
- Sce VMA intein-chitin binding domain (C terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTBY1-T4gp61/41 fusion was a gift from Stephen Benkovic (Addgene plasmid # 228210 ; http://n2t.net/addgene:228210 ; RRID:Addgene_228210) -
For your References section:
Coupling DNA unwinding activity with primer synthesis in the bacteriophage T4 primosome. Manosas M, Spiering MM, Zhuang Z, Benkovic SJ, Croquette V. Nat Chem Biol. 2009 Dec;5(12):904-12. doi: 10.1038/nchembio.236. Epub 2009 Oct 18. 10.1038/nchembio.236 PubMed 19838204