pTYB1-T4gp47
(Plasmid
#228212)
-
PurposeExpression in BL21(DE3) of T4 SbcD-like subunit of palindrome specific endonuclease
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 228212 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTBY1
-
Backbone manufacturerNew England BioLabs
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name47
-
SpeciesEscherichia phage T4
-
Entrez Gene47 (a.k.a. T4p057)
- Promoter T7
-
Tag
/ Fusion Protein
- Sce VMA intein-chitin binding domain (C terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTYB1-T4gp47 was a gift from Stephen Benkovic (Addgene plasmid # 228212 ; http://n2t.net/addgene:228212 ; RRID:Addgene_228212) -
For your References section:
Biochemical characterization of bacteriophage T4 Mre11-Rad50 complex. Herdendorf TJ, Albrecht DW, Benkovic SJ, Nelson SW. J Biol Chem. 2011 Jan 28;286(4):2382-92. doi: 10.1074/jbc.M110.178871. Epub 2010 Nov 15. 10.1074/jbc.M110.178871 PubMed 21081488