pET28b-T4Dda
(Plasmid
#228215)
-
PurposeExpression in BL21(DE3) of T4 Dda-like helicase
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 228215 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET28b
-
Backbone manufacturerEMD Biosciences
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedda
-
SpeciesEscherichia phage T4
-
Entrez Genedda (a.k.a. T4p017, sud)
- Promoter T7
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: This plasmid contains G54E, E151D, N196I, and A357G mutations in T4Dda. These mutations are not known to impact plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28b-T4Dda was a gift from Stephen Benkovic (Addgene plasmid # 228215 ; http://n2t.net/addgene:228215 ; RRID:Addgene_228215)