pB-3xFlag-dCas13-MBD6MBD
(Plasmid
#228233)
-
PurposeFor targeted tethering of the MBD domain of human MBD6 using dCas13
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 228233 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepPB
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namedCas13
- Promoter CAG
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ggcggcggcgccgctagcccaaagaagaagcggaaagtcaacatc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameMBD6
-
SpeciesH. sapiens (human)
-
Insert Size (bp)300
-
Entrez GeneMBD6
- Promoter CAG
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer gccgacggcagcgaattcATGAATGGGGGCAATGAGAGCAG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byDavid Liu, pCMV-dCas13-M3nls (Addgene plasmid #155366 ; http://n2t.net/addgene:155366 ; RRID:Addgene_155366). MBD6 ORF clone was purchased from Origene CAT#: RC208987.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pB-3xFlag-dCas13-MBD6MBD was a gift from Chuan He (Addgene plasmid # 228233 ; http://n2t.net/addgene:228233 ; RRID:Addgene_228233) -
For your References section:
RNA m(5)C oxidation by TET2 regulates chromatin state and leukaemogenesis. Zou Z, Dou X, Li Y, Zhang Z, Wang J, Gao B, Xiao Y, Wang Y, Zhao L, Sun C, Liu Q, Yu X, Wang H, Hong J, Dai Q, Yang FC, Xu M, He C. Nature. 2024 Oct 2. doi: 10.1038/s41586-024-07969-x. 10.1038/s41586-024-07969-x PubMed 39358506