pOPINF HopF2
(Plasmid
#228397)
-
PurposeRecombinant expression of His6-tagged Pseudomonas syringae pv tomato type III effector HopF2 in E. coli
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 228397 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepOPINF
-
Backbone manufacturerBerrow et al. (2007) PMID 17317681
- Backbone size w/o insert (bp) 5202
- Total vector size (bp) 5811
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHopF2
-
SpeciesPseudomonas syringae pv. tomato
-
Insert Size (bp)609
-
Entrez GenehopF2 (a.k.a. PSPTO_RS02615, PSPTO0502, PSPTO_0502)
- Promoter T7 promoter
-
Tag
/ Fusion Protein
- His6 (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.09.25.558804 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOPINF HopF2 was a gift from Lennart Wirthmueller (Addgene plasmid # 228397 ; http://n2t.net/addgene:228397 ; RRID:Addgene_228397) -
For your References section:
Untargeted proteomics identifies plant substrates of the bacterial-derived ADP-ribosyltransferase AvrRpm1. Simranjit Kaur, Thomas Colby, Domenika Thieme, Carsten Proksch, Susanne Matschi, eIvan Matić, and Lennart Wirthmueller. bioRxiv 2023.09.25.558804 10.1101/2023.09.25.558804