pcDNA3.1-EF1A-mNeonGreen2x-SREBP1-P2A-Puro
(Plasmid
#228401)
-
PurposeEncodes a N-terminal truncated version of SREBP1 lacking part of the transcriptional activation domain and fused to a tandem of mNeongreen to visualize the import of SREBP1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 228401 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
- Total vector size (bp) 11651
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSREBP1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3357
-
Mutationdeleted N terminal activation domain (amino acids 1-29)
-
Entrez GeneSREBF1 (a.k.a. HMD, IFAP2, SREBP1, bHLHd1)
- Promoter EF1a
-
Tag
/ Fusion Protein
- mNeonGreen2x (N terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer GGATCTTGGTTCATTCTCAAGCCTC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-EF1A-mNeonGreen2x-SREBP1-P2A-Puro was a gift from Dirk Daelemans (Addgene plasmid # 228401 ; http://n2t.net/addgene:228401 ; RRID:Addgene_228401) -
For your References section:
Ibetazol, a novel inhibitor of importin beta1-mediated nuclear import. Vercruysse T, Vanstreels E, Jacquemyn M, Boland S, Kilonda A, Allasia S, Vandecaetsbeek I, Klaassen H, Versele M, Chaltin P, Marchand A, Daelemans D. Commun Biol. 2024 Nov 23;7(1):1560. doi: 10.1038/s42003-024-07237-8. 10.1038/s42003-024-07237-8 PubMed 39580542