Skip to main content

pOTTC2360 - pAAV rActin EGFP donor
(Plasmid #228444)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 228444 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    Addgene #119870
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    mEGFP
  • Alt name
    Beta actin mEGFP
  • gRNA/shRNA sequence
    TGTGCCTTGATAGTTCGCCA
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    3071

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOTTC2360 - pAAV rActin EGFP donor was a gift from Christopher Richie (Addgene plasmid # 228444 ; http://n2t.net/addgene:228444 ; RRID:Addgene_228444)
  • For your References section:

    Targeted gene transfer into developmentally defined cell populations of the primate brain. Ribeiro Gomes AR, Hamel N, Mastwal S, Wright N, Ide DC, Richie CT, Usdin TB, Wang KH, Leopold DA. Cell Rep. 2025 Dec 21;45(1):116756. doi: 10.1016/j.celrep.2025.116756. 10.1016/j.celrep.2025.116756 PubMed 41428486