pOTTC2360 - pAAV rActin EGFP donor
(Plasmid #228444)

• Purpose: An adeno-associated viral vector to express a SpCas9 guide RNA targeting rat beta actin also carrying an HDR template for insertion of mEGFP to the break site.
• Depositing Lab: Christopher Richie
• Publication: Ribeiro Gomes et al Cell Rep. 2025 Dec 21;45(1):116756. doi: 10.1016/j.celrep.2025.116756.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
• How this works:
  • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: Addgene #119870
• Vector type: Mammalian Expression, AAV, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: mEGFP
• Alt name: Beta actin mEGFP
• gRNA/shRNA sequence: TGTGCCTTGATAGTTCGCCA
• Species: R. norvegicus (rat)
• Insert Size (bp): 3071

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: Unknown

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry