pET-His-SUMO-LS12
(Plasmid
#228451)
-
PurposeLS12 protein expression vector for bacteria
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 228451 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepET
- Total vector size (bp) 6342
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLS12
-
SpeciesSynthetic
- Promoter T7
-
Tag
/ Fusion Protein
- 10xHis-SUMO (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGATGCGTCCGGCGTAGAGG
- 3′ sequencing primer AGGGGTTATGCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-His-SUMO-LS12 was a gift from Keisuke Fukunaga (Addgene plasmid # 228451 ; http://n2t.net/addgene:228451 ; RRID:Addgene_228451) -
For your References section:
Structural insights into lab-coevolved RNA-RBP pairs and applications of synthetic riboswitches in cell-free system. Fukunaga K, Teramoto T, Nakashima M, Ohtani T, Katsuki R, Matsuura T, Yokobayashi Y, Kakuta Y. Nucleic Acids Res. 2025 Mar 20;53(6):gkaf212. doi: 10.1093/nar/gkaf212. 10.1093/nar/gkaf212 PubMed 40119732